stri_locate_all {stringi}R Documentation

Locate Occurrences of a Pattern

Description

These functions may be used e.g. to find the indices (positions), at which a given pattern is matched. stri_locate_all_* locate all the matches. On the other hand, stri_locate_first_* and stri_locate_last_* give the first or the last matches, respectively.

Usage

stri_locate_all(str, ..., regex, fixed, coll, charclass)

stri_locate_first(str, ..., regex, fixed, coll, charclass)

stri_locate_last(str, ..., regex, fixed, coll, charclass)

stri_locate(str, ..., regex, fixed, coll, charclass, mode = c("first", "all",
  "last"))

stri_locate_all_charclass(str, pattern, merge = TRUE, omit_no_match = FALSE)

stri_locate_first_charclass(str, pattern)

stri_locate_last_charclass(str, pattern)

stri_locate_all_coll(str, pattern, omit_no_match = FALSE, ...,
  opts_collator = NULL)

stri_locate_first_coll(str, pattern, ..., opts_collator = NULL)

stri_locate_last_coll(str, pattern, ..., opts_collator = NULL)

stri_locate_all_regex(str, pattern, omit_no_match = FALSE, ...,
  opts_regex = NULL)

stri_locate_first_regex(str, pattern, ..., opts_regex = NULL)

stri_locate_last_regex(str, pattern, ..., opts_regex = NULL)

stri_locate_all_fixed(str, pattern, omit_no_match = FALSE, ...,
  opts_fixed = NULL)

stri_locate_first_fixed(str, pattern, ..., opts_fixed = NULL)

stri_locate_last_fixed(str, pattern, ..., opts_fixed = NULL)

Arguments

str

character vector with strings to search in

...

supplementary arguments passed to the underlying functions, including additional settings for opts_collator, opts_regex, opts_fixed, and so on

mode

single string; one of: "first" (the default), "all", "last"

pattern, regex, fixed, coll, charclass

character vector defining search patterns; for more details refer to stringi-search

merge

single logical value; indicates whether consecutive sequences of indices in the resulting matrix shall be merged; stri_locate_all_charclass only

omit_no_match

single logical value; if FALSE, then 2 missing values will indicate that there was no match; stri_locate_all_* only

opts_collator, opts_fixed, opts_regex

a named list used to tune up a search engine's settings; see stri_opts_collator, stri_opts_fixed, and stri_opts_regex, respectively; NULL for default settings;

Details

Vectorized over str and pattern.

The matched string(s) may be extracted by calling the stri_sub function. Alternatively, you may call stri_extract directly.

stri_locate, stri_locate_all, stri_locate_first, and stri_locate_last are convenience functions. They just call stri_locate_*_*, depending on arguments used. Unless you are a very lazy person, please call the underlying functions directly for better performance.

Value

For stri_locate_all_*, a list of integer matrices is returned. Each list element represents the results of a separate search scenario. The first column gives the start positions of matches, and the second column gives the end positions. Moreover, you may get two NAs in one row for no match (if omit_no_match is FALSE) or NA arguments.

stri_locate_first_* and stri_locate_last_*, on the other hand, return an integer matrix with two columns, giving the start and end positions of the first or the last matches, respectively, and two NAs if and only if they are not found.

For stri_locate_*_regex, if the match is of length 0, end will be one character less than start.

See Also

Other search_locate: stri_locate_all_boundaries, stringi-search

Other indexing: stri_locate_all_boundaries, stri_sub

Examples

stri_locate_all('XaaaaX',
   regex=c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
stri_locate_all('Bartolini', fixed='i')
stri_locate_all('a b c', charclass='\\p{Zs}') # all white spaces

stri_locate_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}')
stri_locate_all_charclass(c('AbcdeFgHijK', 'abc', 'ABC'), '\\p{Ll}', merge=FALSE)
stri_locate_first_charclass('AaBbCc', '\\p{Ll}')
stri_locate_last_charclass('AaBbCc', '\\p{Ll}')

stri_locate_all_coll(c('AaaaaaaA', 'AAAA'), 'a')
stri_locate_first_coll(c('Yy\u00FD', 'AAA'), 'y', strength=2, locale="sk_SK")
stri_locate_last_coll(c('Yy\u00FD', 'AAA'), 'y', strength=1, locale="sk_SK")

pat <- stri_paste("\u0635\u0644\u0649 \u0627\u0644\u0644\u0647 ",
                  "\u0639\u0644\u064a\u0647 \u0648\u0633\u0644\u0645XYZ")
stri_locate_last_coll("\ufdfa\ufdfa\ufdfaXYZ", pat, strength = 1)

stri_locate_all_fixed(c('AaaaaaaA', 'AAAA'), 'a')
stri_locate_all_fixed(c('AaaaaaaA', 'AAAA'), 'a', case_insensitive=TRUE, overlap=TRUE)
stri_locate_first_fixed(c('AaaaaaaA', 'aaa', 'AAA'), 'a')
stri_locate_last_fixed(c('AaaaaaaA', 'aaa', 'AAA'), 'a')

#first row is 1-2 like in locate_first
stri_locate_all_fixed('bbbbb', 'bb')
stri_locate_first_fixed('bbbbb', 'bb')

# but last row is 3-4, unlike in locate_last,
# keep this in mind [overlapping pattern match OK]!
stri_locate_last_fixed('bbbbb', 'bb')

stri_locate_all_regex('XaaaaX',
   c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
stri_locate_first_regex('XaaaaX',
   c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))
stri_locate_last_regex('XaaaaX',
   c('\\p{Ll}', '\\p{Ll}+', '\\p{Ll}{2,3}', '\\p{Ll}{2,3}?'))

# Use regex positive-lookahead to locate overlapping pattern matches:
stri_locate_all_regex("ACAGAGACTTTAGATAGAGAAGA", "(?=AGA)")
# note that start > end here (match of 0 length)



[Package stringi version 1.1.7 Index]